Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST11659-NL
Clone ID PST11659-NL
Vector U3NeoSV1
Project escells

Sequence tag PST11659-NL
Sequence
CCCAAAGGCGAAAACATCGGCCATTCGAAGGCGAGGCAAACGTAACCTTCGGGGGTGGGAAGGCCCGGGTCTTTGGTTCG
GATCCAGGGAATGAATCTGGGACCGGGAAGGAAGCATCCAGGGGGCTCGCGCCAGGCCGAAACCTGTTCGGCCCAGGCTC
CAAGGCGCGCATGGTCCTCTTGCTCTTGGGTTTACAGATGTAAGGATTGCATAGCTTATATATCTTTAATATATTTTCTT
AATTTCTAATTTTGGTTTTGGCATATTTTAAGTATGTCACAAGATCAGATGTATGGAATATGCACATAACTAG
Sequence Type genomic DNA
Unitrap ID UNI5688

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116281046..116281183 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es