Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11565C1
Clone ID IST11565C1
Vector VICTR76
Project tigm

Sequence tag IST11565C1HMR1
Sequence
ATGNNNGNATTTGTACTTGATGCCTGCTGGAAGAGGGAAAACTGACTTTCTCTAACGCAGTGTCTCTGGGTGTATCAGCC
ACACTCCAGGTGTCTCTGGGTGTATCAGCCACACTCCAGGGTCGCTTATGCCCAGGAGCATTGAGTCAAGACAAATGACG
TTTGGTTTTTCANTGCACTTTTTGATTTGTTTGTTTGAATTTATTTATTTATTTATTTTGTTTTGTTTTGTTTTGGAANN
NNNNACAAAGAAAGGAGAGAGGGAAAGCGAGACAGGAACAGAGACTGTGACAGAAGGAGAGAGAATGTGAAGTTGGGTGA
ATAGATNGGTTGGGAGAGTTGGGGGAGGGTAANNANTN
Sequence Type genomic DNA
Unitrap ID UNI15271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20595594..20595937 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


Sequence tag IST11565C1HMF1
Sequence
CTCTGTGCAGGGATTTTGTCTGAGTTTCACTCACACACTCTCGTGTGCCCTGCCACAGTCTGAGTTCATAGGTGTCTCAG
CTCTGCTATGTTTGGAAGATGTGGTTTTCTTGAAGTCGCCATCATCTCTGTCTGTTACAATCTTCCTCCCTCCTCTTCTG
CNTGGATCCCTGAGCTCTTAAGGGAGGTTTTGGTAAAGTCNTCCCAATTANGGCTGTGTAANAGCTACCATTTTTGTTAA
CG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20595315..20595555 233
NO GENE  


Sequence tag IST11565C1BBF1
Sequence
CTCTGTGCAGGGATTTTGTCTGAGTTTCACTCACACACTCTCGTGTGCCCTGCCACAGTCTGAGTTCATAGGTGTCTCAG
CTCTGCTATGTTTGGAAGATGTGGTTTTCTTGAAGTCGCCATCATCTCTGTCTGTTACAATCTTCCTCCCTCCTCTTCTG
CATGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20595388..20595555 168
NO GENE  

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es