Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12069B12
Clone ID IST12069B12
Vector VICTR76
Project tigm

Sequence tag IST12069B12HMF2
Sequence
TAGGAAGTGTCCAGATTTCCTCCCACCCTGCCATCTCCCCTGACAAAGGCGTTAGAAGACAGCATTTGTTAAGAGAAAGA
ACCCAATGAAGCAAAGCTCCCAAGGAACACAAAGGGTACACTGACGTCATAGTGTGCATCAGCCGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 65763573..65763720 148
NO GENE  


Sequence tag IST12069B12BBF1
Sequence
AGAGCACCCGACTGCTCTTCCAAAGGTCCGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGAG
ATCTGT
Sequence Type genomic DNA
Unitrap ID UNI107 UNI34954

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 162892751..162892835 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61034234..61034318 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037151 (Lrrc20) NM_153542 leucine rich repeat containing 20 Gene [Source:MGI Symbol;Acc:MGI:2387182]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 83079491..83079575 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 93289775..93289859 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 46658070..46658154 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 88095344..88095428 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134602213..134602297 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70402555..70402639 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032212 (Sltm) NM_025690 SAFB-like, transcription modulator Gene [Source:MGI Symbol;Acc:MGI:1913910]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165789: 200262..200346 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103249040..103249124 85
NO GENE  

 
Come back to gene ENSMUSG00000032212


For any suggestions or comments, please send an email to unitrap@crg.es