Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14722H6
Clone ID IST14722H6
Vector VICTR76
Project tigm

Sequence tag IST14722H6HMR1
Sequence
TCATGATGGAGGACCTTTGCGTTAGCATTATTTCTGACTAATGGCTTTGTAAAACCGAAGAAACCGATCTTTGTTGGGGG
TTGGAGGCAANAAAGAAAGAAAAGTGTGAAATACAGGGCAAAGGAGGGGCTCCTCTAGGCTTTGTCAGGGACCCTANGAA
ACAAATGACTTTTTCCTCTTCCCCAAGGGTTGGCACATGAACTCAGGGTANAAATANAAGTGGGCCTTTCTCCCTTTGTG
TGCACACATGTTTGCGTTTAAAAACAAGCCTGTANGTTGAAAGCTGCCCTTGCCTTGGCAGGTANTANANAACC
Sequence Type genomic DNA
Unitrap ID UNI10404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 62954266..62954579 296
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021932 (Rnaseh2b) NM_026001 ribonuclease H2, subunit B Gene [Source:MGI (curated);Acc:Rnaseh2b-001]


Sequence tag IST14722H6HMF1
Sequence
ATGAAACAGGAAAACTAGCTTTCCCTTCCATAACTGATTCTTTTTTTTTAAATCTTTTTAATGAAAACATAATTCTAAAA
TGGGAATTCTTANAATANTTTTAATTCTTGCTTTGTTTTGTATTTANATGTCNTTTGTGGTCATCACNATGCCCCAGGCT
GAAAAGCTACTGCCCGCNAATGGCTANGATGGCAGGCAGGGACTCCCCAAAGGCTACCTGTCCTTTATCCTCCAAACAAA
CTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 62954024..62954269 232
NO GENE  

 
Come back to gene ENSMUSG00000021932


For any suggestions or comments, please send an email to unitrap@crg.es