Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14951A10
Clone ID IST14951A10
Vector VICTR76
Project tigm

Sequence tag IST14951A10BBF1
Sequence
ATACACACACATACAACACAAAGAAACCTTGGGGGGTTAAAAAGTCAAGTACGGCCGGGCAGTGGTGGCCCACACCTTTA
ATCCCAGCACTTGGGAGGCAGAGGCAAGCGGATTTCTGAGTTCAAGGCCAGCCTGGCCTACAGAGTGAGTTCCAGGACAG
CCAGGGCTACAGAGAAACCCTGTCTCAAAAAAACCAATGGGGGCTGGAGAGATGGCTCANTGGTTAANAGCACTGACTAC
TCTTCCGAAGGTACTGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCTGTAATGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 135547529..135547838 304
 
EST/CDNA Est Name
  AW258573.1 - CF537241.1 - CF892419.1 - CA885298.2 - CA572882.2 - CA543805.1 - CA571447.1 - CA872915.2 - CN661353.1 - CA572982.1 - CN724131.1 - CA880857.2 - CA536648.1 - CA532010.1 - CA572182.1 - AA472674.1 - CA571329.1 - BY225673.1 - BY268562.1 - BE627562


Sequence tag IST14951A10HMF1
Sequence
ATACACACACATACAACACAAAGAAACCTTGGGGGGTTAAAAAGTCAAGTACGGCCGGGCAGTGGTGGCCCACACCTTTA
ATCCCAGCACTTGGGAGGCAGAGGCAAGCGGATTTCTGAGTTCAAGGCCAGCCTGGCCTACAGAGTGAGTTCCAGGACAG
CCAGGGCTACAGAGAAACCCTGTCTCAAAAAAACCAATGGGGGCTGGANAGATGGCTCAGTGGTTAANAGCACTGACTAC
TCTTCCGAAGGTACTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGANATCTGATGCCCTCTT
CTGGTGTGTCTGANNANAGCTACAGTGTACTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 135547529..135547880 340
 
EST/CDNA Est Name
  DV062295.1 - CN716891.1 - CN697234.1 - CA571301.2 - AW258573.1 - CN699094.1 - CF537241.1 - CA572844.1 - CN714409.1 - CF892419.1 - CF894575.1 - CF899414.1 - CN687111.1 - CA571166.1 - CN713144.1 - CF907206.1 - CN688125.1 - CA885298.2 - CF901501.1 - CA571472


Sequence tag IST14951A10HMR1
Sequence
ATAATAATTGGATTGTGTGTTTTTATATGGGCTTATTGGAGTTGGAAATTCCAGCAACAAACTGAGTTTATTGTTTTTGA
AGCATGTTATCCAGCTCTCTGGCAATGAAGTGCAGACTGCTAACTCTCCAAGCCATAGCTAGGAGTTATTGCTTTGTTAC
TGGGGTCCTCTTTGAANCATTTTGTTCTACTATCTAAATGCAACTTTTGGGAAAAAATTAAAAT
Sequence Type genomic DNA
Unitrap ID UNI19977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164856528..164856751 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039804 (Ncoa5) NM_144892 nuclear receptor coactivator 5 Gene [Source:MGI (curated);Acc:Ncoa5-007]

 
Come back to gene ENSMUSG00000039804


For any suggestions or comments, please send an email to unitrap@crg.es