Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10453A11
Clone ID IST10453A11
Vector VICTR76
Project tigm

Sequence tag IST10453A11HMR1
Sequence
NANNNGGCTGGCCTCTAACTCANAAATACGCCTGCCTCTGCCTCCCGAGTGCTGAGATTAAAGGCGTGCGCCA
Sequence Type genomic DNA
Unitrap ID UNI19691

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4799453..4799520 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034274 (Thoc5) NM_172438 THO complex 5 Gene [Source:MGI (curated);Acc:Thoc5-001]


Sequence tag IST10453A11BBF1
Sequence
TACAAACTAAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCAAAAAACAAAACGAAACAAAAAAATTAAAA
ATACACTGTATGAAAAATTCAAAGAATTAATAAAAGTATTTTTTTTTAAAAAAGAGAGGAAGGGCTGGAGAGATGGCTCA
GGGGTTAGGAGTGCTGGCTGCTCTTCCAAAGGACCTAGGTTTAATTCCCAGCATCCACATGGCAGCTCACAGCTGTCTGT
AACTCCAATTCCAGAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4799188..4799447 258
 
EST/CDNA Est Name
  BU525160.1

 
Come back to gene BU525160.1


For any suggestions or comments, please send an email to unitrap@crg.es