Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14293D2
Clone ID IST14293D2
Vector VICTR74
Project tigm

Sequence tag IST14293D2HMR1
Sequence
GATTTTAGTCTGCACAGGTGAGAGTCTGCACCACAGAAGCTGACAGCTTCTGGGAACTGCCAAAGCAACACAGTGTCTGA
GAAAGGTCCTGTTTTGGGCCTTCTTCTTCGGCCAGGAGGAGGTCCAAATACAAGATATCTGCGCACCTTCCCTATAAGAG
AGCTTGCCAGCAGAGAGTGCTCTGAGCACTGAAACTCANAGGANAGAATCTGTCTCCCAGGTCTGCTGANAGACGGTAAC
AGAATCNCCANAANAACNNTCTCTAANCNNANTCC
Sequence Type genomic DNA
Unitrap ID UNI34956 UNI34957

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 32542213..32542478 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 115678585..115678850 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 55228656..55228921 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022371 (Col14a1) NM_181277 collagen, type XIV, alpha 1 Gene [Source:MGI (curated);Acc:Col14a1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 78351548..78351813 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022865 (Cxadr) NM_001025192 coxsackie virus and adenovirus receptor Gene [Source:MGI (curated);Acc:Cxadr-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 45182280..45182545 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 59430675..59430940 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 7621111..7621376 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 18118075..18118340 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 38307648..38307913 250
NO GENE  

 
Come back to gene ENSMUSG00000022865


For any suggestions or comments, please send an email to unitrap@crg.es