Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14954D3
Clone ID IST14954D3
Vector VICTR76
Project tigm

Sequence tag IST14954D3BBF1
Sequence
NCGGGAGCCTCTTCACCTGCAGTATGTACCATTGGTGCCTCTCCCGTTATCATTACCTGGATTGTTTTAAGGAACTAAAG
TAACTTTAAAAGTTCAAATTGCGCCGGGTGGTGGTGGCGCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGG
ATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGTCAGGGCTATCCAGAGAAACCCTGTCTCANG
AAAAANAAAAAAAANNTTNNAATTGCTTTTGCTAANCNTATTATATANATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 149322404..149322695 272
 
EST/CDNA Est Name
  BE648664.1 - CA465227.1 - BE853934.1 - AW908309.1 - BG791826.1 - CK343497.1 - AA388507.1 - BE992926.1 - BY089050.1 - BY168709.1 - BY159166.1 - BE989754.1 - BE989889.1 - BE989973.1 - BY169876.1


Sequence tag IST14954D3HMF1
Sequence
NNGGGAGCCTCTTCACCTGCAGTATGTACCATTGGTGCCTCTCCCGTTATCATTACCTGGATTGTTTTAAGGAACTAAAG
TAACTTTAAAAGTTCAAATTGCGCCGGGTGGTGGTGGCGCATGCCTNTAANCCCANCACTTGGGANGCANAGGCAGGTGG
ATTTCTGANTTCAAGGCCNNCCTGGTCTACAANNNGANTTCCANGACAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14954D3HMR1
Sequence
CCGCCTGTTCTGGAAATTGATCACATCANCTANATGTTACTCGCTTTGAAAAGTCCTTCTTTAAGTCCCTCTTTCCTGAG
TTTGCCAGATCTACTCAGCATATACTAGAGTGCATAAAAGGGCTCCTTTTATACAAAGTACTTAAATTAATATTCTAGGT
CTAAACCACTATAATATCTTGCACTAAAAGCCAGTAAATGTATTTGTTGGATCTTGTAAGAAAAAAATAGTAAATTCTGG
AGCANTANAAGAAAAGTCTTTGGGTGCCCTGCCCTGAGGAAGGAGCAGGCTGGCAGGTGGACTCCTTGGCTGTCTGGTCT
GCTAATCACATCANTGACACCNNAGTCCTCCTAANCCGTGTTCTGTACATGTCCCTCTGGGGCCTNNANAGGAGAANGGC
ACATCTNATGANGCCGTGAANGATAATGGAAAGGCATGGCTTCACTATGCTTN
Sequence Type genomic DNA
Unitrap ID UNI3913

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 149321955..149322406 422
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001687 (Ubl3) NM_011908 ubiquitin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1344373]

 
Come back to gene ENSMUSG00000001687


For any suggestions or comments, please send an email to unitrap@crg.es