Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12078F7
Clone ID IST12078F7
Vector VICTR76
Project tigm

Sequence tag IST12078F7HMF1
Sequence
CCTCTGCCTCCCAANTGCTGGGATTAAAGGTGTGCTTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112666026..112666064 37
NO GENE  


Sequence tag IST12078F7BBF2
Sequence
CCTCTGCCTCCCAAGTGCTGGGATTAAAGGTGTGCT
Sequence Type genomic DNA
Unitrap ID UNI2895 UNI31810 UNI32719 UNI32720

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 54753490..54753525 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052331 (Ankrd44) NM_001081433 ankyrin repeat domain 44 Gene [Source:MGI Symbol;Acc:MGI:3045243]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 36279860..36279895 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4598543..4598578 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 41539389..41539424 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 40750554..40750589 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 18731409..18731444 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021779 (Thrb) NM_009380 thyroid hormone receptor beta Gene [Source:MGI (curated);Acc:Thrb-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 26713898..26713933 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 28265184..28265219 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022523 (Fgf12) NM_183064 fibroblast growth factor 12 Gene [Source:MGI Symbol;Acc:MGI:109183]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37554083..37554118 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27231371..27231406 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 45255618..45255653 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 84224084..84224119 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40593300..40593335 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 10406968..10407003 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 51405592..51405627 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13522294..13522329 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28382345..28382380 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031490 (Eif4ebp1) NM_007918 eukaryotic translation initiation factor 4E binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:103267]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20813642..20813677 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 58786081..58786116 36
NO GENE  

 
Come back to gene ENSMUSG00000031490


For any suggestions or comments, please send an email to unitrap@crg.es