Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14637D5
Clone ID IST14637D5
Vector VICTR74
Project tigm

Sequence tag IST14637D5HMF1
Sequence
GGGTTGATGAAGCATCTTTTAAGGGCAATGCTTATCCTTAAAATTGCTATGATGGGATGCAGTTCATGTTCCTTGCAAAC
TTCAGAATGGCCCATGACATGGTACCCTTGGCATTTCTAAAGTAGGACATGGCAACCCATAACGGGTAGGGGAGTCAGAG
TATTTCTTAGAATTGAGGAAAGCCTCAGGACTTTAGAATCTTCCATAAGAAAAGCTTTTGTGAGGAATATGACATCTCCA
CCANACCANCAGGTAGTTGGGTTTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTNNNCCCCACCCNCNNTCANTGTANTG
CAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55004225..55004548 304
NO GENE  


Sequence tag IST14637D5HMR1
Sequence
ACCCTTATNATGCTGGGTCTGCAAAGAAGTTAAATATTGGCAGACATGCGTCTTCTTAAAACTATATAATTAATATTCAT
TTCATCAATTGCATTTTCTTGTGAATCTTCTTGGGATAATTCTAAAAAAATGTCTATTTATTCCAGATAGGAAAGACATT
GACCACCGTACTGACCAGGCCAGCTGGGTGAACCANTGTGTTTATTGAGGGACATTTACAAGANGTANNGTGAATCAAAG
TCTTCTGGGTCACTAGACCCCTACTCTNGGN
Sequence Type genomic DNA
Unitrap ID UNI2859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55004545..55004814 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]


Sequence tag IST14637D5BBF1
Sequence
GGGTTGATGAAGCATCTTTTAAGGGCAATGCTTATCCTTAAAATTGCTATGATGGGATGCAGTTCATGTTCCTTGCAAAC
TTCANAATGGCCCATGACATGGTACCCTTGGCATTTCTAAAGTAGGACATGGCAACCCATAACGGGTAGGGGAGTCAGAG
TATTTCTTANAATTGAGGAAAGCCTCAGGACTTTAGAATCTTCCATAAGAAAAGCTTTTGTGAGGAATATGACATCTCCA
CCAGACCAGCAGGTAGTTGGGTTTTTGTTTGTTTGTTTGTNNNNNNGTNNGTTTTTGCCNNANCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55004250..55004548 279
NO GENE  

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es