Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST11493-NR
Clone ID PST11493-NR
Vector U3NeoSV1
Project escells

Sequence tag PST11493-NR
Sequence
GACCAAACCAAATGTTTTTCAAACTCTGATCTGTCTCAAATAAGCTTCTTTTTGAAACTAACTTGATTTAAGTTTTGTTT
TTCATTTTGTTTTTGTTGTTTTTGTTTTTAATAAGACCAGTTTCATCCAGGCAGACCTCTTAACTAAAACTCCTGTCTCC
AATTCCTGAGTGCCTCCTGGTGTTGAATGTACAGCATTTTGGCTACCCTTTTTTTTTTTTTTATAAAAGAGGAGATATGC
CCCTGTGTTCCCGCGCGCTCTTTTTTTTATATTTTCTTTTTTTTTTAAAAATATTTCTCTTTTAGAGAGA
Sequence Type genomic DNA
Unitrap ID UNI15185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40673912..40674143 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028410 (Dnaja1) NM_008298 DnaJ (Hsp40) homolog, subfamily A, member 1 Gene [Source:MGI (curated);Acc:Dnaja1-001]

 
Come back to gene ENSMUSG00000028410


For any suggestions or comments, please send an email to unitrap@crg.es