Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15089E6
Clone ID IST15089E6
Vector VICTR80
Project tigm

Sequence tag IST15089E6HMF2
Sequence
GTGGTGCTGGAGGATCTGTGTGAAAACTCATGTCAGCATACAGGTTTGCATCCAGCAAGCATCCTGAACACTGTAGAAAC
AGGAAGTTATCTGGTTATCTGGTGTTTTTCTCTGGTACAGCTTAGTTCTGGTTAAACTTAGTTCTAAGCAATCAAAAATA
ATGCTTGGGTTTTTTGTTTGGTTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53120646..53120850 205
NO GENE  


Sequence tag IST15089E6HMR1
Sequence
TNNAAATCCCAGTAACTTGGTAAAATNAAAACTCTAAACCGGGCGTGGTGACACACGCCTTTAATCCCAGCACTTGGGAG
GCAGAGGCAGGCGAATTTCTGAGTTCGAGGACAGCCTGGTCTACAGAGTGAGTTCCAGGTCAGCCAGGGCTACACAGAGA
AACCCTGTCTTGAAAAAGAAAAACAAAAACAGAAAAAAACCTCTAGAGGCTTGTAATTTATAAGTCAGATATATATCAGT
AAATTCTCACCCCATAAAATGCCCACACAATGAACTCAGAGCCAATTGATATTGATATAAAATGCCCAACTAGATAAGAC
AATGTATTATTCCATCCCTTCTATGATATTCATAGCACCTGT
Sequence Type genomic DNA
Unitrap ID UNI30506

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155045529..155045887 357
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042202 (A530082C11Rik) NM_177186 RIKEN cDNA A530082C11 gene Gene [Source:MGI Symbol;Acc:MGI:2444240]


Sequence tag IST15089E6BBF1
Sequence
GTGGTGCTGGAGGATCTGTGTGAAAACTCATGTCAGCATACAGGTTTGCATCCAGCAAGCATCCTGAACACTGTAGAAAC
AGGAAGTTATCTGGTTATCTGGTGTTTTTCTCTGGTACAGCTTAGTTCTGGTTAAACTTAGTTCTAAGCAATCAAAAATA
ATGCTTGGGTTTTTTGTTTGGTTTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53120646..53120851 206
NO GENE  

 
Come back to gene ENSMUSG00000042202


For any suggestions or comments, please send an email to unitrap@crg.es