Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10307D4
Clone ID IST10307D4
Vector VICTR76
Project tigm

Sequence tag IST10307D4BBF1
Sequence
TTAGAGAGTGGATGAAGCTCAAGCCAGGAAGCGTCTGTCTTCCGACCNGACGAAGCATGCATCCAAGCCAAGCTTCGAAC
CTGCCTTCCACCAGGACAGCTCCCGAGGTCCGGCCAGTCCTAAAGACAGCCCGCCAGAGACCAAGAGGCCGCAGTACAGT
TCTGAAACCCAGTCCAAGAAAGTTTTCCTGAACAAGGCTGCCGATTTCATCGAAGAACTTTCCTCCCTTTTNAAGGCTCA
CAGCTCCAAGNNGATNNNACCTCGGGCCTGCAAAAACCACAAGAGCAAGACGGAATCCCAAAACAAAGTTCTGCAGGAAA
ACAGCCCCACTTTCTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI34965

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62655432..62655771 326
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020067 (Mypn) myopalladin Gene [Source:MGI Symbol;Acc:MGI:1916052]


Sequence tag IST10307D4HMF1
Sequence
TTAGAGAGTGGATGAAGCTCAAGCCAGGAAGCGTCTGTCTTCCGACCAGACGAAGCATGCATCCAAGCCAAGCTTCGAAC
CTGCCTTCCACCAGGACAGCTCCCGAGGTCCGGCCAGTCCTAAAGACAGCCCGCCAGAGACCAAGAGGCCGCAGTACAGT
TCTGAAACCCAGTCCAAGAAAGTTTTCCTGAACAAGGCTGCCGATTTCATCGAAGAACTTTCCTCCCTTTTNAAGGCTCA
CAGCTCCNAGAGGATCNNACCTCGGGCCTGCAAAAACCACAAGAGCAAGACGGAATCCCAAAACAAAGTTCTGCANGAAA
ACAGCCCCACTTTCTCAGATCTAACAGAAAGGCGAGAGAGAGCATCGGTCCCCATTCCCATCCCTGCGGACAGCAGGGAT
AACGAGCTGAANNACGCTATTGAACAGCGAGAAGCCNAGANGAGGGAAGCCGAGTTGGCTGCGGGGGG
Sequence Type genomic DNA
Unitrap ID UNI34965

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62655307..62655771 447
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020067 (Mypn) myopalladin Gene [Source:MGI Symbol;Acc:MGI:1916052]

 
Come back to gene ENSMUSG00000020067


For any suggestions or comments, please send an email to unitrap@crg.es