Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11063C6
Clone ID IST11063C6
Vector VICTR76
Project tigm

Sequence tag IST11063C6BBF1
Sequence
CCGAGAGACACCTGGTAGCCATTCGCAGCCATGTAACTTAATACAAGATATTAAAGTGGGAGGCGACCAGGAATGGAAAT
GTAGTTCACATTTCGCTGAATGGAACAGAATGGAATTGGCTCATTTATGTTAGGACAGGTACGGTTAACCAAGTGGTATC
AGGTCTCAGGCATTTTAATGAGTCCCGAAATGAACTTCCCCACAACTGCTGTGGAACACAGCGAGCAAGCGCCCTACGGT
GGAATGGGGATCGCCCTGTCTTCTGACCGCTCCACTCCCANANTANGTAGTTGGTAATTGAATTAGCAGAGCTGGCATTC
ACAACATTCTCTTGGTATCCCATCTCAAAGGGCGTGTGAATTCAGAGAATTCAGAAGGNNCCAGCAGCTAAGTCTCANGC
CCAGTCATGTTTACCCACTTGCCGTCAGCTGTGCTTANGTAACGTGATACATAAAAGTGGCCCAGGGAAATGACAGGGAG
CAGAATGTCGNCTGACAGGGAAACAGGAGTTAACNGGAAACACNTGGTCTTGACNCAAATGAACCTGCGCTGCTTN

Sequence Type genomic DNA
Unitrap ID UNI25019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118771709..118772263 533
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039115 (Itga9) NM_133721 integrin alpha 9 Gene [Source:MGI Symbol;Acc:MGI:104756]


Sequence tag IST11063C6HMF1
Sequence
CCGAGAGACACCTGGTAGCCATTCGCAGCCATGTAACTTAATACAAGATATTAAAGTGGGAGGCGACCAGGAATGGAAAT
GTAGTTCACATTTCGCTGAATGGAACAGAATGGAATTGGCTCATTTATGTTAGGACAGGTACGGTTAACG

Sequence Type genomic DNA
Unitrap ID UNI25019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118771709..118771857 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039115 (Itga9) NM_133721 integrin alpha 9 Gene [Source:MGI Symbol;Acc:MGI:104756]

 
Come back to gene ENSMUSG00000039115


For any suggestions or comments, please send an email to unitrap@crg.es