Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12430C2
Clone ID IST12430C2
Vector VICTR76
Project tigm

Sequence tag IST12430C2HMF1
Sequence
GGAGCTCTCTATGTTGCCCCCTCCATCCTTAGAGTAAGCCAAGGAGATAAGAGAGATGTGGTGATTAAAGGATTGGCAGC
TCTTGGCTCTGTNACCTTGNNCN
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56870887..56870985 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]


Sequence tag IST12430C2BBF1
Sequence
GGAGCTCTCTATGTTGCCCCCTCCATCCTTANAGTAAGCCAAGGAGATAAGAGAGATGTGGTGATTAAAGGATTGGCNGC
TCTTGGCTCTGTGACCTTGGGCANATTCTNAANTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038816


For any suggestions or comments, please send an email to unitrap@crg.es