Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13115D12
Clone ID IST13115D12
Vector VICTR76
Project tigm

Sequence tag IST13115D12HMF1
Sequence
CCTTCCCTTCCCTTCCCTTCCCTTCCCTTTTTTCTTCTTATCTTTTATTTTTGGGCANCATCTCTATTATACTATAGCCC
AGGCAGGACTTGAACTTTCAAGCTCAACCTTCCANGTNNCTGANATTCTAGGCCTGANCNACTGGTCAAGCCCAGACCAC
TAATTCTTANCTCANANGCCCACAGANGGCACGGGTTGCTGANGGGCATANAGCCTGGGANGACNANNAANNNNNANGGG
ATNAANANTCTGGANATAAAAGCCCTGTGTGTCCTGTGGGANACANCACCCTTCCTGANNACAATTGCTCTCTTCCNATG
GATTTTATATNNAGGNNNNGGANGACTATCAACCTGCANACNNTCTGANCTCCNGCTCTTGGGCCCNTGGANNGAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13115D12BBF1
Sequence
ATGTTAAGGTGTTAAAGTCCTGCAAAGACCCTTCAGGACAGGGCTCAAGGCTGGTTCCTGAGCCTANAAAAAAAATCTGC
CCCACCCCACCCCAGTAAGGTCGAGGCCGGCAGCTCANTTGGGTCTTTAAAAGGGACTTATTTATTACAGACTCCTGAGG
TCANACAGATGCAAAGCGATACTTGAAGTTTTTCTTTGCTAATATTCGGTACTTATGGTAATTCATTGGTAAATGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30596

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168521074..168521312 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027546 (Atp9a) NM_015731 ATPase, class II, type 9A Gene [Source:MGI (curated);Acc:Atp9a-003]

 
Come back to gene ENSMUSG00000027546


For any suggestions or comments, please send an email to unitrap@crg.es