Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST10894-NR
Clone ID PST10894-NR
Vector U3NeoSV1
Project escells

Sequence tag PST10894-NR
Sequence
GGAAGGAAAGAAGGAAGAAAGAAGAAACAAAGAAAACTACAAGAATTTATCTATGTGGGAAAACAGATAACAAAGATACT
TGGATTAGAAAAGCAGGCGTCATGCCAGGCAGTGGTGACACACACCTTTGGCCCCAGTACTCAGGAGACAGGCAGGCAGA
TGTCCTAGTTTGAAGCCCAAACTGGTTTACAGAGCAAGTCCCAGGAACCAG
Sequence Type genomic DNA
Unitrap ID UNI15192

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101532812..101533016 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045273 (Cenph) NM_021886 centromere protein H Gene [Source:MGI Symbol;Acc:MGI:1349448]

 
Come back to gene ENSMUSG00000045273


For any suggestions or comments, please send an email to unitrap@crg.es