Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST10698-NL
Clone ID PST10698-NL
Vector U3NeoSV1
Project escells

Sequence tag PST10698-NL
Sequence
GTTGGNATTGGGAAGGAAAAGGCCCGGCCAAATTGAAGTTAAAGGGGAGGGGTTAATAAATTTGGGACCTTGCCCTGGGT
GGTTTTTAAGGAATGGCCTTGGGGTTTCCAAGGGGGATTGGGAAAGGGTTCAACCCGGCAAAGATGGGCAGGTGCCAGGT
GGGCACCACGCTGCTTGGAAGCTTTGGATTGTATCCTACCACCAACTCGTCCAACTGACAAGCCTCTGCGACTGCCCCTC
CAGGATGTCTATAAAATTGGAGGTAAGTAGAATATTAAGTAGAATGTTGACGTGAATTTGAAGTCTTATGTTTTGTGTAT
TAAATAC
Sequence Type genomic DNA
Unitrap ID UNI15193

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78327366..78327553 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037742 (Eef1a1) NM_010106 eukaryotic translation elongation factor 1 alpha 1 Gene [Source:MGI (curated);Acc:Eef1a1-001]

 
Come back to gene ENSMUSG00000037742


For any suggestions or comments, please send an email to unitrap@crg.es