Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12271G3
Clone ID IST12271G3
Vector VICTR76
Project tigm

Sequence tag IST12271G3HMF1
Sequence
AGTTACATTTAGACCAATCAGAGAATAATAATTTTTGTAGCTACAACCATAAAAATAAAAAACACTTTACCATTGTCAAA
CACATTAATCATGAACCATTTATTAGCTTTTTTACTCTGAAACTTAGAGA
Sequence Type genomic DNA
Unitrap ID UNI31033 UNI32041

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10811417..10811545 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 29594179..29594307 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 15072389..15072517 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 50020904..50021032 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 19012805..19012933 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31380923..31381051 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 54259186..54259314 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44895844..44895972 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 110306642..110306770 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3327597..3327725 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40554432..40554560 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 87466753..87466881 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 133963694..133963822 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 27382094..27382222 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 131625832..131625960 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056018 (1700008F21Rik) NP_083568 RIKEN cDNA 1700008F21 gene Gene [Source:MGI Symbol;Acc:MGI:1922703]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7804066..7804194 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 18769..18897 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 36067049..36067177 129
NO GENE  

 
Come back to gene ENSMUSG00000056018


For any suggestions or comments, please send an email to unitrap@crg.es