Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14564G3
Clone ID IST14564G3
Vector VICTR74
Project tigm

Sequence tag IST14564G3HMR1
Sequence
GGGTACCAGGGATACGGTTTTCCAGGTCTTCTGTGGGGTGCTCCACTGCGCGAACCACGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7252138..7252197 60
NO GENE  


Sequence tag IST14564G3BBF1
Sequence
CCCCTGGGCCCTGGCTGGTGCCCAGCGAGGACCGGCTCTCGCGGGCTCTAGGGGTTCGGGGTGGGGGCGCGCAGCTTGCT
CTGGAGATGGCAGCCGGAAGGCGGAGGCATTGAGCACCAATAGACAGCTTTGTGCTCACTAGGTGAGGTCCCATAAGGTT
CTAGCATGCAGGACCGCCAGGCTCTAAGCTTTTCCCTTANAGCTTTAACCTGGTTTAGTACCTTCCCACTGCACATTGCA
CAGTGGAGTGGTCCCCACCCCTTCAAGACGCCAGTGGTATGGCCCTCCCAGANCCCAGAGCGCTCGCACCCCACCACCCC
CACGTCCGCGTGCGCGCAGCTTCTCCTAGTCCCTTCCCGACCGGGANGTAATAAAATAGTTGGN
Sequence Type genomic DNA
Unitrap ID UNI29306

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7251758..7252140 377
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031147 (Magix) NM_018832 MAGI family member, X-linked Gene [Source:MGI (curated);Acc:Magix-001]


Sequence tag IST14564G3HMF1
Sequence
CCCCTGGGCCCTGGCTGGTGCCCAGCGAGGACCGGCTCTCGCGGGCTCTAGGGGTTCGGGGTGGGGGCGCGCAGCTTGCT
CTGGAGATGGCAGCCGGAAGGCGGAGGCATTGAGCACCAATAGACAGCTTTGTGCTCACTAN
Sequence Type genomic DNA
Unitrap ID UNI29306

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7252000..7252140 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031147 (Magix) NM_018832 MAGI family member, X-linked Gene [Source:MGI (curated);Acc:Magix-001]

 
Come back to gene ENSMUSG00000031147


For any suggestions or comments, please send an email to unitrap@crg.es