Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST9971-NR
Clone ID PST9971-NR
Vector U3NeoSV1
Project escells

Sequence tag PST9971-NR
Sequence
GCCAGTGCAGATCTTTTGGATTGGATGATTGAATACAATTTCTTCTTTGCTGCTGATTTAATTCATTGAGCTGAGACAGC
ATAGGTTGGTGTTCTTCAAATGACAAACTGAATTAAATAGGGTCCTGCAGTATGCTTATCTTTTAAAAAAATTATATTTA
ACACAGCCCTGCTCATTTGTAGACACATTGCTAATAGCCATTTCCATGCTACAATGACAGATTTGAGGAGTTGTGGGAGA
TCAAATGGCCGACAGCCTAATATTAGCATCTAAT
Sequence Type genomic DNA
Unitrap ID UNI15199

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 86230284..86230557 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038047 (6230416J20Rik) NM_173400 RIKEN cDNA 6230416J20 gene Gene [Source:MGI Symbol;Acc:MGI:1923389]

 
Come back to gene ENSMUSG00000038047


For any suggestions or comments, please send an email to unitrap@crg.es