Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST9939-NR
Clone ID PST9939-NR
Vector U3NeoSV1
Project escells

Sequence tag PST9939-NR
Sequence
TTACATACATGGAGCAAGCCATGGTACTTGTCCTTGGTCCTCACGGTCCTCACTCGCAGCACTCCCAGTGCTGGTCACCC
TGTACACCTGTTGTTCTTTGTGTTTTGTTTTTCAAGAGAAGTATTTCTGTCACCTAGGCTGCTCTTAAAATCAGTCCTCC
TGCCTAGGGCCCTGCTGAGTACAGGTTTGCATCAGCATG
Sequence Type genomic DNA
Unitrap ID UNI6061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 129308019..129308179 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030867 (Plk1) NM_011121 polo-like kinase 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97621]

 
Come back to gene ENSMUSG00000030867


For any suggestions or comments, please send an email to unitrap@crg.es