Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12124B3
Clone ID IST12124B3
Vector VICTR76
Project tigm

Sequence tag IST12124B3HMR1
Sequence
TGAGGAACATGGGAGAGTCNNNNNGCTNANGCTGGGTCAGTGGANNGNACAGGCAGAGGAACTATACTGNTTTNTGCNNA
GTTTCTANNNGAACNAGTGGGTGTCCCTGGNNCNACNGATCATCGATGTTTCTGAGGACCACNNNNNNANTCGGGANGCN
NNCACGGGTCCNTGGTTCCCGACTCAGAGGAAATCNNAGAAACCCATAAAGTAAAATCACCTGTTCATGCGAATGGTANA
GCTGGGATTGAAAGCAACAGANCANCCTGGCGTGGTGGTGCACACCTTTGCTCCCNNCACTTGGGAGACAGAGGTGGGCA
GATTTCTGAGTTCGAGGCCNGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGAGCTATAGAGAACCCAGTCTCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12124B3BBF1
Sequence
CTCAGCCTCAGGACAGCATTTGGCCGCCTTCCCATCTTAGGACAGTTTCCAGACCTTCAGGAGCTTGATCTG
Sequence Type genomic DNA
Unitrap ID UNI13104

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3235717..3235787 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034614 (Pik3ip1) NM_178149 phosphoinositide-3-kinase interacting protein 1 Gene [Source:MGI (curated);Acc:Pik3ip1-001]


Sequence tag IST12124B3HMF1
Sequence
CTCAGCCTCAGGACAGCATTTGGCCGCCTTCCCATCTTAGGACAGTTTCCAGACCTTCAGGAGCTTGATCTANNNNNCCN
NCANTTCCAAGCTCAGCGGGTGCCCCGTGCAGAAGCCAGGTATTTTTCTTTTAGTTTTACTCTTTTAGGCTGTCATGGGT
CTGCCACGTGACCTTGAGTGAACTTTCCGGTACATGGGGTGGGGGGTGGGGGAAGGCACTNNNTCNCCNNATTCCCTGTN
NCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000034614


For any suggestions or comments, please send an email to unitrap@crg.es