Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13958C12
Clone ID IST13958C12
Vector VICTR74
Project tigm

Sequence tag IST13958C12HMF2
Sequence
CCACCCACTGTTGATCTTGAGAGTTACACGCAAAGTCTAGATGGTAGTCTTATGATTTTTATTTTTCTCATTATGAGAGC
TTCCTACTTGAGCACCAGCACCTTTCTCTGAGCAAACCACACTTGTGATGAAACTCTGTTCATGCTTCTATTGATTTACA
TTAAAAATAAAAATCCCCCAAACCAGCTTAGTGGTGGTGGTGCACCCCTTTAATGCATTTGGGAGGCAGAGGTAGGTGGG
TCTCTGAATTTAATACCAGCTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI16496

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12534780..12535044 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]


Sequence tag IST13958C12BBF1
Sequence
ATCAAACCCAGGACTTCCTGCTGTAAGGGTCCATGATTCGCAGAAGAATGATACCCTGAACTCAAATAGTATGTAAAAGC
AAAGAGTGTTTATTCTGCCGANNNNNNGCATGCTGGGGTCNCCCATTCAAGATGGAGACAACCAAGTGAGCTTGAAGGCC
CAATTTAAAGCACATTAGGGGAATTCCAGGGTAGATGACCTTTATCTTGCTCCATCTCTAGGGACATTCCAGAACCTTTA
CAGGACATGAGGGCTGGAAACTGTTGCTGACCCATTGCTCTTGCTTCAGGTGGGGCAGCTTGTGATGGCAAGGCTGCTAG
ATTCTGACTAGCTGCCTGAAGCCTGGGGTTTTCCCTAGTAACTGACTTGCCTGGGCTTGCCCANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 143734814..143735201 372
 
EST/CDNA Est Name
  DV065650.1

 
Come back to gene DV065650.1


For any suggestions or comments, please send an email to unitrap@crg.es