Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11656D4
Clone ID IST11656D4
Vector VICTR76
Project tigm

Sequence tag IST11656D4BBF1
Sequence
NACTATTATGAGTCCTAATGTAAATATCTGTGTTTTCCAATGGTCCTAGGCCATCCCCGTGAAAGGGTTATTTTACATGC
TCCCCTGACTCCCAAGGAGTTCCTACCTACAGGTTGAGAACCGTTGCTGTAGCCATTGTGAGGGTCTCTTCTCTCCAGAG
TACTCTATAGGTCAGTTTATCATTACNGAAACAGTACCTANTANAATAAATNNNNNNGTTTATAAACATTTAAGGGCACG
ATGAGAAATACTTTCTCACCCTGCTTTCCNANATCTG
Sequence Type genomic DNA
Unitrap ID UNI25472

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45916379..45916653 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011256 (Adam19) NM_009616 a disintegrin and metallopeptidase domain 19 (meltrin beta) Gene [Source:MGI (curated);Acc:Adam19-001]


Sequence tag IST11656D4HMF1
Sequence
CTACTATTATGAGTCCTAATGTAAATATCTGTGTTTTCCAATGGTCCTANGCCATCCCCGTGAAAGGGTTATTTTACATG
CTCCCCTGACTCCCAAGGAGTTCCTACCTACAGGTTGAGAACCGTTGCTGTAGCCATTGTGAGGGTCTCTTCTCTCCAGA
GTACTCTATAGGTCAGTTTATCATTACAGAAACAGTACCTANTANAATAAATNNNNNTGTTTATAAACATTTAAGGGCAC
GATGAGAAATACTTTCTCACCCTGCTTTCCNANATCTTACCCCGTTTCTGGATGCANCCATAAACTACCNGTTTCTTATG
TCCCCCATACTCACTCCTGGCAAAANGAACTTCNATACATGATATAATGTTTTATAACTTTGGGCCCTAACCACNTTGGG
AATTGGGTTAATNNNTGACTGCGGATCTTAACAAAGACNCAGCANACCACAGCNNAATGCTTCATGTCNACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000011256


For any suggestions or comments, please send an email to unitrap@crg.es