Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11375C2
Clone ID IST11375C2
Vector VICTR76
Project tigm

Sequence tag IST11375C2HMF1
Sequence
CAAACAAACAAACAAACAAAAAACCAAACCAAACAAACAAAAAAACCAAAACATTTTTATTGGTGGTGTGTGTGCCACAC
ACGTGTGAGTGCCTGAGTGGAGGCCTGAGAGGGCATCANATTCTTGGAGCTGGAGTTGTAGGTGATTGTGAGCTTCCTGT
CATGAGTGATGAGCCATCTCTCTACCTCTCATTCNACAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI20533

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27423772..27423975 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040818 (A630054L15Rik) NP_001127937 family with sequence similarity 116, member A Gene [Source:MGI Symbol;Acc:MGI:2442980]

 
Come back to gene ENSMUSG00000040818


For any suggestions or comments, please send an email to unitrap@crg.es