Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11190A6
Clone ID IST11190A6
Vector VICTR76
Project tigm

Sequence tag IST11190A6BBF1
Sequence
CTCTGCAGGCTGATGTGGTTGCCCCGAGTCCTCTNAGGACAGGAAATCCCTCANATGCTCCAGACTGCCTCTGCCTTCTT
TCTCTCACTCTCCACTTTCTTGCTTAGATTCCTCCCCTGAGTACCTTAGTTTCCACAGGGTGACTCCCAANAGGCCAATT
TGTGTACACACAANCCCACGGGCCCAANNAGGACAAAGGTATTTGTTTGTTGAGTGTTGTCTGANTACAACCGANCTGAC
TCTGCTGAGGACAGCANACAAANAGACAAAATTAATTAAAGAAAGAAAAAAACAAAACAGAAAAAAGGAAAAAAAAANTA
NTTGTANTAATANTAATAANAANAATAAGTAAATAAATAANTAAATAAGCNCTAACTGCTCTTCCAAAGAGCCGANATGT
GATTTCCAGCATCTCCNCGGTGACTAACAACTGTCTGTAACTCTAGTTCCNGANGANCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11190A6HMR1
Sequence
CNNACAGATANGCTGGACTCACATTCCTCGTGCCTCAGACTCCTAGCCCTGGAGCCTGGATTACAGGGACAACCTANCAC
ACAGACTATATCTAANATTTATCGTTGCTCCTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI12540

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21590498..21590619 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032194 (Kank2) NM_145611 KN motif and ankyrin repeat domains 2 Gene [Source:MGI Symbol;Acc:MGI:2384568]


Sequence tag IST11190A6HMF2
Sequence
AGTNAAGAGATTGGGTGGTGGTGGTGGTGGTGTGAATCCCAATCTTGGAAAACAACAAAAATACCAAGGATGGCTGANAT
GGTTCAAGTGGGTANAGGAACTTGTCCGTANTTCAAGTTTTANAACCCACATTGTGGAGGGAAAGAAACAACTTCTAGGT
TGTCCTCCACACTAAGCGCATGTAACAGGTTTCAAATCCCANACAAATGGCTGANGTGCCTATTTAACACANCANATGGA
ACCTGACCTCTTGGCTCTGCCTGCATTCTTCCTCCCCANAGTCTANCATATCCTGCCCCCTGCCTACCTAAAACTTCTCT
AGTCCAGGGACTGGGCTGCCCTTCCCANTGCCCTTCCCTATACACTCCACCTATTGTGGTTACCANGCCTTGGTGTTNAC
TTTCTTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78217216..78217623 380
NO GENE  

 
Come back to gene ENSMUSG00000032194


For any suggestions or comments, please send an email to unitrap@crg.es