Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST9845-NR
Clone ID PST9845-NR
Vector U3NeoSV1
Project escells

Sequence tag PST9845-NR
Sequence
AGTCTTCTATCCCGGTGGTCAACCAGATTAATCCAATTTCAGTTATCTACTGGCTAATAACAACACTTTTTTTTTATTAT
ATTTAATTTGTAAGGACAGTATATAGCTTTCCGTTTTTAGCCATTCTGTGTCAGGAATAAAGTTGCCTAATTTATATTTT
ATACATCCCAGTGGCATTGAAAGTCCTAGGAAATACTAATGATTGGGAGGTAATTTCAAAATCTTGTGCTCATTTTGTCT
AATTGGGGGTCATCATAATGTATAATTTAGGAA
Sequence Type genomic DNA
Unitrap ID UNI15210

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88514826..88515095 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028060 (2810403A07Rik) NM_028814 RIKEN cDNA 2810403A07 gene Gene [Source:MGI Symbol;Acc:MGI:1921450]

 
Come back to gene ENSMUSG00000028060


For any suggestions or comments, please send an email to unitrap@crg.es