Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST9843-NR
Clone ID PST9843-NR
Vector U3NeoSV1
Project escells

Sequence tag PST9843-NR
Sequence
GACTGTGTTGCTCAGTGGTCTCCTGTTTCTGTGAGTGCCTAATTCTGCTCATCCTTTCAGAGAGCCCTGCACGCTATAGC
AACAAGGAGCTGAAGGGAATGCTGGTGTGGTCCCCCAACCACTGTGTATCAGATGCCAAACGTGAGTGCGCTGGGCCCAG
GTCACGTTCAGTCTCAGGAACAGGGTTTTAGTTCCTGTCCTCCTAAGGCTAGCTCTTCCTTAGAAGTGAGCTGTTGCCGG
GCAGTGGTGGCGCACGCCTTTAATCCCAGCACTTG
Sequence Type genomic DNA
Unitrap ID UNI15211

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7344531..7344805 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024968 (Rcor2) NM_054048 REST corepressor 2 Gene [Source:MGI (curated);Acc:Rcor2-001]

 
Come back to gene ENSMUSG00000024968


For any suggestions or comments, please send an email to unitrap@crg.es