Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14910H11
Clone ID IST14910H11
Vector VICTR76
Project tigm

Sequence tag IST14910H11HMF1
Sequence
AGGGCTTTATATAAAGCCTGGCACGGGTGTCCAACAAACATTCT
Sequence Type genomic DNA
Unitrap ID UNI21893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91824495..91824538 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027230 (Creb3l1) NM_011957 cAMP responsive element binding protein 3-like 1 Gene [Source:MGI (curated);Acc:Creb3l1-001]

 
Come back to gene ENSMUSG00000027230


For any suggestions or comments, please send an email to unitrap@crg.es