Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12799C5
Clone ID IST12799C5
Vector VICTR76
Project tigm

Sequence tag IST12799C5HMF1
Sequence
CCTGCTTATGGCTTGCTTCCCATGGCTTGCTCANTCTGCTTTTTCATAGAACCCAGGACCACCATTTCAGGGATGGCACC
TCCCACAATGGGCTGGGTCTTCCCCCACTTGGTCACTAATTGANAAAATGTCTTTCAGCTGGATCTCATGAAGGCATTTT
CTCAAGGGAGGTTCCTTCCTCTCTGACAACTCTAGCACATCAAGGTGACATACAAAACCNGCCAGCACAGCGGGATAACA
GGAGACAAATACNTTTGTGGTATCCTAAGAGGGAATGTGGAGGAGGCAAGGGTGGANTCANACAAGTCTGCAGGCTACTT
TTCCNGTCNNANCNNAGGGAGGTCAAGGTCANCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 93598385..93598735 327
NO GENE  


Sequence tag IST12799C5BBF1
Sequence
ATTATATGTAAGTACACTGTAGCTGTCTTCANACACACCAGAAGAGGGAGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI31311 UNI31312 UNI31313 UNI31884

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166402: 2062..2119 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 144675..144732 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4767045..4767102 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3494101..3494158 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15109911..15109968 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4688815..4688872 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004069 (Dnaja3) NM_023646 DnaJ (Hsp40) homolog, subfamily A, member 3 Gene [Source:MGI (curated);Acc:Dnaja3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8056391..8056448 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 5299688..5299745 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8219610..8219667 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037669 (1110057K04Rik) NM_172401 RIKEN cDNA 1110057K04 gene Gene [Source:MGI Symbol;Acc:MGI:1916082]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3251539..3251596 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 16142473..16142530 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14751586..14751643 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079357 (AC171681.1)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6144132..6144189 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 10074648..10074705 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 5681002..5681059 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029757 (Dync1i1) NM_010063 dynein cytoplasmic 1 intermediate chain 1 Gene [Source:MGI (curated);Acc:Dync1i1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3234165..3234222 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 6626106..6626163 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11073348..11073405 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 19909980..19910037 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5486410..5486467 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 11321845..11321902 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6417274..6417331 56
NO GENE  

 
Come back to gene ENSMUSG00000029757


For any suggestions or comments, please send an email to unitrap@crg.es