Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11966F9
Clone ID IST11966F9
Vector VICTR76
Project tigm

Sequence tag IST11966F9BBF1
Sequence
NACATCACTGCTATCTTCTATATGTTGACTATTCANCATATTTTCTAAAGAGACTTCTTTGTCCCTATGTAACCAAAGCA
TTGCAAATATTAAGTTATTAACACACTGAAAAATGCAATCAATCAGATGATTATCATCTAATGTTTTAATGATCACATTT
TTAATCCAATTATGCATGTTTGAATCTTTCAAATTTTCTTTAATTAAAACTTGCCTCTTGGCACTGCTATCANNAAGGAN
AAATTGNNCNNAATGANCCAN
Sequence Type genomic DNA
Unitrap ID UNI30647

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12934584..12934842 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]

 
Come back to gene ENSMUSG00000021745


For any suggestions or comments, please send an email to unitrap@crg.es