Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10115G1
Clone ID IST10115G1
Vector VICTR76
Project tigm

Sequence tag IST10115G1BBR1
Sequence
TTCCTCGGGTCAAGAGGGGTTCAGGGCACCGGACTCCGAACATAGGATAGAAAAGGGAACTGGAGAGTGTTGCTGGGCGA
TGAGAAGGAGCAGCTTCCCGAGTGTTGTCCGGAGCTGTTTCCCTCCAGACCCACACTAACCATAACCAGCAAAGCTCTGG
TTCTTGGTCTGGATCAGAGCCAGGAATGCTGAGAGCAGCAGGAGGGTGGCACAGGGTGCTGTAGGCCCCATCCTTGATGT
GTGGAAAGTCTGGAGGGACTGAGACTTTGTTCCTCTCTGTGGAGTTTCTAGCACTGTGGGTTGTGGGAAGAACCACAGTG
ACTGTGAATAGTTCTCTAAAATTCCTACATGCACTGGGAGTGAGAACATGGGTCCAGATGGAAGAACAGCGCAACTGACA
CAGTTTGTAAGCTACCCAGAGAGAATTCAGAAGGGACAAGGGACTTCCCAACCCATGGCTTCCCCACCACAGACACCTTG
AAGACAAAAACCTCACACTGGGGACTTAGGAAAGCCCACTTCCTCCTGTACTTGGTGCTCTTTGACACATCTGCTCTCTC
TGAGTCCTGTTAAGGACCTTTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37108111..37108694 584
 
EST/CDNA Est Name
  EH096046.1


Sequence tag IST10115G1HMF1
Sequence
NACCACCAGAGATCCCCAGGATGAGGTCGGGGTCTCACCGCGCTCTGTCTGCAGGTTCACATTCCTTGCGGTATTTGGTA
ACCACGACCGTGTCTGGACCAGGTCTTCGAGATTCCCATGTCTTCATTGTTGGCTACATGAACTACATGCAGTTTATGCG
CTTTGACAGTGATGGAACTACTCAGAGGATCCAGGCGCGAGGGCCCTGGGTGAAGCAGATGGGGCCTGTGTATTTGGAGA
TGGAAAGAAGGAAAATGGANAGCTATTCACACAGGGCCCGNNAAAACCTGCGATTCGCAATCCAGGTCTACAACCNGAGC
GACNAGGGTGAGTGACCCCTTCACATCTCCACAGACNNATCTAAGTCGCCCAGGGTCCCAAACCCTN
Sequence Type genomic DNA
Unitrap ID UNI32335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37107727..37108111 371
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083534 (CR956641.9)  

 
Come back to gene ENSMUSG00000083534


For any suggestions or comments, please send an email to unitrap@crg.es