Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14662C4
Clone ID IST14662C4
Vector VICTR74
Project tigm

Sequence tag IST14662C4BBF1
Sequence
ACTTTTCGTGGTTTTAAGTCNAATCACATCCNAGTTTCTTTCNNCCAATACCGTGTGCAGTGTCTTGCTTACACCTCTGA
AGCTTTAAACTAAGCTCTCCTTAAGTTTCCGGTCGAACTTCTCATTTTCAGCAGCACGAAAATGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 163244317..163244467 143
 
EST/CDNA Est Name
  CJ052968.1


Sequence tag IST14662C4HMR1
Sequence
AACTTCTTATGGGCCTTTTGCAAGTCTGAGGTCTTTGGGCATTCTTTGGAAGTAAGAGCAGTGAAGGGGTAATAGGAGAA
TTTCCCACAATGTAATGTAAATGAAGATAGGCAATCCACTCACCTGTTGTATAAAGCTGTTGGGTTGATGCTTCCATAAT
GGAAAGCTAGGAACTGGGAGGANCATAACAACCCATTTGTAATTGCAAGCATGCTCTGATCTANCCCCCTAGGTTAAGCC
TAGGATACTCTTGCTCTGGCTTAAAGTAATTGAAGAAAAACATGAGCAGTCNCAGTGGTGGACGTTTGAAAACAAGTTAN
GCGATNCTTTATTCTCANAGTTTTTGGTTTGCAGCCNNATTTNNATTTTGGGCTGNTNNGGTNTN
Sequence Type genomic DNA
Unitrap ID UNI26191

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 163243935..163244316 356
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035399 (RP23-117O11.3) NM_025699 Uncharacterized protein C20orf111 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q9D722]

 
Come back to gene ENSMUSG00000035399


For any suggestions or comments, please send an email to unitrap@crg.es