Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14619B9
Clone ID IST14619B9
Vector VICTR74
Project tigm

Sequence tag IST14619B9HMR1
Sequence
ATAGAAAGTTTCATTTTAAAACTAATGGCAGGTGGTTCAAAGTGCAGTTTCAAACAATAACTGAGGGCTGAAAACATAAG
GTTTCATCTTGGGGGAAAAATATAAAGGAACCCAGCTATTGGGGGGGGGGGTNACNNAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI30916

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18166727..18166868 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039835 (Nhsl1) NM_173390 NHS-like 1 Gene [Source:MGI Symbol;Acc:MGI:106390]


Sequence tag IST14619B9HMF1
Sequence
CTATNACNATTTCTAAGTGCTTTTGTACTTAAGTATGTCCTTTTTCTCTATTTTTGACTCTGTATAATAACNAATTTTAA
AATAAACTGACACATGGTTGTATGTCAAGCAAAACCCCAACCTGGGGCCACGGATACATCTCTGTTATTCTTGTGAGCTT
TTAAAATTCCACTGGCATCTCTCCTGCTGCTTGATACTTGAANATAGGCTTTAAAGGGACTACACCCTGTCATGTGTCTA
ACATTANCTTCTTTGTCTTTGCTTTGTAGTGTTTAAACAANAAAGCAAGTCNAGCCNGCTGTATAAGCAACATGGGAAGC
CCTGGGGGTGNCTCTTNNNCCNCCCCTCCTTAACCTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18166373..18166730 329
NO GENE  

 
Come back to gene ENSMUSG00000039835


For any suggestions or comments, please send an email to unitrap@crg.es