Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST9598-NR
Clone ID PST9598-NR
Vector U3NeoSV1
Project escells

Sequence tag PST9598-NR
Sequence
ATGGTTAGGGATGGTATGCTGGAGAGTTGACCTTGAGTAATCATTGTGATGGGCAGTGATGGAGTCCCGTTTGATTAGGG
TAGTGTGTCAGCAGGGGCTTAGTCTTGAGCCTCGGAGTGGGATCAGAAGTGCTGAGACTACACATTAATGCTCTGTGGCA
ATCTGGTACTGTTCCCACAGCAGCCCCGCACATCCAGCCAGGTCACCTTCCCCATTGACTTTTTTGAACACAACCCAGCA
GCTAACAGATGTGGAGTTTGGCGGTAATGACCTCTTGC
Sequence Type genomic DNA
Unitrap ID UNI12196

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 138985227..138985502 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066036 (Ubr4) ubiquitin protein ligase E3 component n-recognin 4 Gene [Source:MGI (curated);Acc:Ubr4-001]

 
Come back to gene ENSMUSG00000066036


For any suggestions or comments, please send an email to unitrap@crg.es