Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14977H5
Clone ID IST14977H5
Vector VICTR76
Project tigm

Sequence tag IST14977H5HMR1
Sequence
CTACGAGTCTANNNNNNNGGNNTCNGANNNNTGGGTATAGAGGNNNAGAAAAAGGTGAGCTTAGACTGTAAGAAAGAGCA
AAGCTCCAGCAGACTCAGGAGAGATAGATAATTAGTGAAAATAGAGATGAAAGAGATTAGAGAGGTCCAAGATGAGAGAG
ATACCCCGAATGAGAAATATTTAGAGTANAACATGTAAGAGGCAGAGAAGGCGCATTGANAGANANAGAGAGAGNGGGGT
GGGGGGGCNNGANGCAGAAGAAAGAGAANNCNGGNGGGATCGTANACNAGAAAGANNTTGGACTANANNCNNGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14977H5HMF1
Sequence
GTAGGTGCTCCTTACCTGGGACAGAAGTTTTAAGTGGGCGGATGTCTCCTTCAATGGTTAGCAGCTTAGGGCGGGGCTGC
CCTAGAAGAGAAAACATGTGGGGCTGGGAAAGGGAAGGCAGTTCTCACAGCTGCCAACTGGGGGGGNNNGN
Sequence Type genomic DNA
Unitrap ID UNI34980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122109724..122109869 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031831 (Lrrc50) NM_026648 leucine rich repeat containing 50 Gene [Source:MGI (curated);Acc:Lrrc50-001]

 
Come back to gene ENSMUSG00000031831


For any suggestions or comments, please send an email to unitrap@crg.es