Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14745G12
Clone ID IST14745G12
Vector VICTR76
Project tigm

Sequence tag IST14745G12HMF1
Sequence
TTTGTTGTTCTAATATTTCTCACCCTGTGGTCTGTCCCTCACTGTATGCTCAGGTCACCCTGGAACTCATAAAACTTTTG
CCTCAGCCTCTTCAGTGCTGGGATCATCACCACAACCAGCGTGTCTGTACTTTTAAAGAAATCCTCCCTGCCCAGGTCCC
AAAGATACTCTTCTGCANCTTATTACGTTAGCTGTATACTTTTGCTTTTAGTTTAAGGTCCTCANTCCTTCTATANGGTT
CAGCTCANTGGCANAGTGCCTTCCTAGTATGTGCAANTCCCTTGNCTTANATCCCAACAAAGANAGAGAGCTGNNTNTGC
NTNNACTGTGCCATTGAACCNNATGCNNNANNANNATCTATNNNANNANNNANGCNNGNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14745G12HMR1
Sequence
CAAAAAGTATTCAACTAAAGATAACTACNNNCNAATNNAATAAAAATCCATGAAAATCACTGAGAANNGNGGGAATAAGC
TTACCAGGAATTACAGATGAATGGCATCCAAAGGGTAGCAAATCGATTTGTGGTGGGGTTGGTGGAGGAGTGGGAGGCAG
GCCTTTACAATGTTGAACAAATTTATTCTANGANTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14745G12BBF1
Sequence
TTTGTTGTTCTAATATTTCTCACCCTGTGGTCTGTCCCTCACTGTATGCTCAGGTCACCCTGGAACTCATAAAACTTTTG
CCTCAGCCTCTTCAGTGCTGGGATCATCACCACAACCAGCGTGTCTGTACTTTTAAAGAAATCCTCCCTGCCCAGGTCCC
AAAGATACTCTTCTGCAGCTTATTACGTTAGCTGTATACTTTTGCTTTTAGTTTAAGGTCCTCAGTCCTTCTATAGGGTT
CAGCTCANTGGCANAGTGCCTTCCTANTNTGTGCAAGTCCCTTGGCTTATATCCCAACAAAGANAGANAGCTGTGTCTGC
TTTTACTGTGCCNTTGAACCANATGCCTCATNACCATCTATCANNAAACTGAGGCANGGTTGTGAATTGGAGCTTTNNCA
NGTTN
Sequence Type genomic DNA
Unitrap ID UNI27298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7723825..7724228 374
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055188 (2900002K06Rik) RIKEN cDNA 2900002K06 gene Gene [Source:MGI Symbol;Acc:MGI:1917476]

 
Come back to gene ENSMUSG00000055188


For any suggestions or comments, please send an email to unitrap@crg.es