Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XP0113
Clone ID XP0113
Vector pGT0lxf
Project sanger

Sequence tag XP0113
Sequence
GTCCCCGGTGGAGGTTGAGCGCATCAAAATTGAGAGTCTTCTTTACAGAATTGCCTCATTCTTGCAATTG
Sequence Type mRNA
Unitrap ID UNI2638

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 107436410..107436479 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020721 (Helz) NM_198298 helicase with zinc finger domain Gene [Source:MGI (curated);Acc:Helz-002]

 
Come back to gene ENSMUSG00000020721


For any suggestions or comments, please send an email to unitrap@crg.es