Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST5533-NR
Clone ID PST5533-NR
Vector U3NeoSV1
Project escells

Sequence tag PST5533-NR
Sequence
GGGACCCCATTATTTTTTATCACTCCCCTGTCCTTGCTTTCACATTTATCATCTGGAGTCCAAGGACTCATCAGAGGGAC
TTGGCTTGGCAGGACGACGTCCCAGTGCGATGAGAGTCCGTCTTCTGCATTTTCCTACCCCCTCCACCCTCCCCTCAAAG
CCATCCATCCTCCAGCGTTCTTTCCCCCTTGAACGTGCATCCGCACACGGACCCAGTCCGGGTGACAGTGTGGCTCTCTC
TGATCACTCAGATTGTTGTGTCCCTGAGGACAGGGGGACGCT
Sequence Type genomic DNA
Unitrap ID UNI134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122608752..122609032 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004455 (Ppp1cc) NM_013636 protein phosphatase 1, catalytic subunit, gamma isoform Gene [Source:MGI (curated);Acc:Ppp1cc-001]

 
Come back to gene ENSMUSG00000004455


For any suggestions or comments, please send an email to unitrap@crg.es