Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14301H7
Clone ID IST14301H7
Vector VICTR74
Project tigm

Sequence tag IST14301H7HMR1
Sequence
GTGGGTAAGTCNTGGTGGCATTTGCCTTAATCTCGGCATTTAGGAGGCAGAGACAGCCAGACTCTTAAGAGTTTTAGGCC
ATCCAGATTTACATAGTGAGTCCTAGGACAGCTGTGGATACATATTAACAACTTGTCTTAAACAAAAAAATCCAAAACCA
NCAAAAATTAAAATTAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI4483

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17173124..17173309 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038965 (Ube2l3) NM_009456 ubiquitin-conjugating enzyme E2L 3 Gene [Source:MGI (curated);Acc:Ube2l3-001]


Sequence tag IST14301H7BBF1
Sequence
CCTCCCTCTTCTTAAAAGGCAGTGGTGACCAATGCAAACTAATCCCAGAACTCAGAGGCAGATGGTTCTCTGTGAGTTTG
AAGCCAGTCTGGTCCACATAGTGAGTTCCGGGAAAGCCAGGACTATACAGAGAAACCCTATCCAAAAAAACCAAAAATAA
GTTAAGTAAATAAAAAAATAAAAATTTAAGCATTTTAATAAATGTGAATGGTGTCTTTTATCTGCCATTCTAACACTAAN
AGGCTGAAGCTGGAGAACGGCTCTGAATTCAAAGCCAGTCTCAGCTACAAAGTAAAACCCTGCCACAGTNNAAAGGGAAC
CAAAAGTGGTATCTACACACCTGCNNNNNNNAGATNCNNNCAGGAGGATCAGGAGTTTANNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17173315..17173693 351
 
EST/CDNA Est Name
  BG078962.2 - DV054262.1 - DV066494.1 - W41238.1 - DW711849.1 - BQ963344.1 - BG800638.1 - AI875951.1 - CN841975.1 - BG079801.2 - BX511830.1 - CJ041605.1 - AW211066.1 - AA397263.1 - CJ039944.1 - AA271627.1 - AA028469.1 - AI574432.1 - BU513843.1 - AW012465.1

 
Come back to gene BG078962.2 - DV054262.1 - DV066494.1 - W41238.1 - DW711849.1 - BQ963344.1 - BG800638.1 - AI875951.1 - CN841975.1 - BG079801.2 - BX511830.1 - CJ041605.1 - AW211066.1 - AA397263.1 - CJ039944.1 - AA271627.1 - AA028469.1 - AI574432.1 - BU513843.1 - AW012465.1


For any suggestions or comments, please send an email to unitrap@crg.es