Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14953H6
Clone ID IST14953H6
Vector VICTR76
Project tigm

Sequence tag IST14953H6HMR1
Sequence
ATTNTAATAATTGGATTGTGTGTTTTTATATGGGCTTATTGGAGTTGGAAATTCCAGCAACAAACTGAGTTTATTGTTTT
TGAAGCATGTTATCCAGCTCTCTGGCAATGAAGTGCAGACTGCTAACTCTCCAAGCCATAGCTAGGAGTTATTGCTTTGT
TACTGGGGTCCTCTTTGAAGCATTTTGTTCTACTATCTAAATGCNNCTTTTGGGAAAAAATTAAAAT
Sequence Type genomic DNA
Unitrap ID UNI19977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164856528..164856754 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039804 (Ncoa5) NM_144892 nuclear receptor coactivator 5 Gene [Source:MGI (curated);Acc:Ncoa5-007]


Sequence tag IST14953H6HMF1
Sequence
ATCCAACTTTGGAAGACAGAGAAAGGGACAAAGCAGAGTGATTTGTTCAGTTATGATAACAAGGTGGAATAAAACAAACC
AGCCACTTCTCTTCCTCATGTAGCCCAAGTTGCCTCCAAACTTATTAAGTGGCTGAAGATGACATTGAACTTGCCTCTGA
AAGTAGAGATAACAGGCCTGGGTCCTGGCGCGCTCTCTCTCTCTCTCTCTCTCTCN
Sequence Type genomic DNA
Unitrap ID UNI29812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93241369..93241583 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]

 
Come back to gene ENSMUSG00000029381


For any suggestions or comments, please send an email to unitrap@crg.es