Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10154F6
Clone ID IST10154F6
Vector VICTR76
Project tigm

Sequence tag IST10154F6BBF1
Sequence
TTGGAAGCCAGCTGCTGCTCAGCGCCACTCGGCCAAGTTCTCTGTGAGGCTGTTGCTTGTGCGTCGTGGCTAAGGAAGGC
AAGCATGAGTAGGCGCAGAGCCATGCTCTTTTCCCTTCTGACAGACACTGATGTCATCCCTCAGAAGAGTTCAAGGAATC
CAGTTCACTCNNACTTGGGAAGAAGGAAGGAAGGAAGCAGATATTCCTGGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 183958675..183958890 212
NO GENE  


Sequence tag IST10154F6HMF1
Sequence
AAACCAAAATAAAATAAAATAAAATAAAATAAAATA
Sequence Type genomic DNA
Unitrap ID UNI31595 UNI31596

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 65853890..65853925 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119972482..119972517 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 86324308..86324343 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 44385936..44385971 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038725 (Pkhd1l1) NP_619615 polycystic kidney and hepatic disease 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:2183153]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 34397324..34397359 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26373051..26373086 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33882717..33882752 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 90180837..90180872 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 48718071..48718106 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72367358..72367393 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 100865941..100865976 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 108807492..108807527 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034551 (Hdx) NM_001080549 highly divergent homeobox Gene [Source:MGI (curated);Acc:Hdx-002]

 
Come back to gene ENSMUSG00000034551


For any suggestions or comments, please send an email to unitrap@crg.es