Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15016D11
Clone ID IST15016D11
Vector VICTR78
Project tigm

Sequence tag IST15016D11HMF1
Sequence
ACNNTGTCTGAAGTTATGAGCTTGCTTGAGCTAACCTCACAGCATCCAGCGAAGACACTAAGAACAGGTCACACAGAAAC
ACTGAGATCAGCTGATTTACACAGAGGAACATGCAGGCTTAGTACCTGGAAGAGTCACTGCCTCTTCTGACTGGCAACTC
CTTGCGGAGGTTCTGATGGCTATTGAGTCTTATTGAAATGAGCACCACCCTTAGGGTTAGAGTGTGCTGAAGGGACACAG
CAGAGTGGTTCCNGCCTGGGCCAATCCTTTTCCANATCTGCAGATTTGCANTTCANTANCACCNNTGTGTCTCCTCCAAT
ANTCTGTTCNNNNCCCANGCCCNNGNNANAGGCTAANATTCCNGATCCCNGTTGCTTACCTGCNNGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15016D11BBF1
Sequence
ACCATGTCTGAAGTTATGAGCTTGCTTGAGCTAACCTCACAGCATCCAGCGAAGACACTAAGAACAGGTCACACAGAAAC
ACTGAGATCAGCTGATTTACACAGAGGAACATGCAGGCTTAGTACCTGGAAGAGTCACTGCCTCTTCTGACTGGCAACTC
CTTGCGGAGGTTCTGATGGCTATTGAGTCTTATTGAAATGAGCACCACCCTTAGGGTTAGAGTGTGCTGAAGGGACACAG
CAGAGTGGTTCCAGCCTGGGCCAATCCTTTTCCAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177359672..177359951 280
 
EST/CDNA Est Name
  CN690235.1


Sequence tag IST15016D11HMR1
Sequence
ATGGTAAGTGCAATGTTATCTCTCACAAAGATGAGGAGCTAGCATCTTAGAAAAGGATACTAGCGGGGCGTGGTGGCGCA
TGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTC
CAGGATAGCCAGAGCTATACAGAGAAACCCTGTCTTGAAAAAACAAAAAATAATAAAAAAATATATATATAAAAAAAAAA
AN
Sequence Type genomic DNA
Unitrap ID UNI34981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177359436..177359676 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078865 (OTTMUSG00000016574) predicted gene, OTTMUSG00000016574 Gene [Source:MGI Symbol;Acc:MGI:3649838]

 
Come back to gene ENSMUSG00000078865


For any suggestions or comments, please send an email to unitrap@crg.es