Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST4479-NR
Clone ID PST4479-NR
Vector U3NeoSV1
Project escells

Sequence tag PST4479-NR
Sequence
TTAGGAATCATGGGAGACAGGCTTAGCAAGGGGGGGAGGGATGCCGCTTTTCTAATATTGCTGGAAATGGCTTCACCTTG
CTGTCTCCCCTACCCCTGCAAACGCTGTCTCCCTGAAGTGCACACCCCAAAGACTGACGATTACCAAGAGAAGACCGATG
ATTCTCAGGAGACCCAGGACTCCCAGAAAGTGGAACTCAGTGAGCCCAGGTGAGTTCTTCCGGGGATGCCACCAGCCGCC
GCCGATGACCTTAGAGCTAGAGCTCCACCCAGGCTCGCCCCAGGGTGTTGCA
Sequence Type genomic DNA
Unitrap ID UNI573

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 20794806..20795106 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041859 (Mcm3) NM_008563 minichromosome maintenance deficient 3 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:101845]

 
Come back to gene ENSMUSG00000041859


For any suggestions or comments, please send an email to unitrap@crg.es