Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST3305-NR
Clone ID PST3305-NR
Vector U3NeoSV1
Project escells

Sequence tag PST3305-NR
Sequence
TTACTAGCTTTTTACTGTGGTAGAATAGTGATACAATTTTGTATATTTGGTTAAACTTAGACAAACTTAAAATCCATTTC
AAAGATTGTTATGTTGAGTGTACCAGGTCAGTGAGAGACTAATGATATTCTCCACAGACGTGAAAAAACACTCCTATCTA
TATGAAGAATATTATTTATTATTTTATGCTTAACTTATCCCACTACTGTCTTTCTCTGGTGCTTTTGAGTACCATCAAGT
AAGCTAACGTTTCTTCATTACTTTAGATTATGATAGTCTTACCC
Sequence Type genomic DNA
Unitrap ID UNI6927

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9160139..9160419 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042508 (Dmtf1) NM_011806 cyclin D binding myb-like transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1344415]

 
Come back to gene ENSMUSG00000042508


For any suggestions or comments, please send an email to unitrap@crg.es