Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10130E9
Clone ID IST10130E9
Vector VICTR76
Project tigm

Sequence tag IST10130E9BBR1
Sequence
GTTTGACCTGACTTAACAAATTTACTGTCCATACCTACATAATCTATACCAATACCAATACTAACCCATACTAACACCTC
CCTCATCCCTAGTTCGAAGGACACCTACCCCAAACCCAAGAAACCCCTTTCCTCATTCAATCTATTTATTTTGAGACAGT
CTCACCATATATGTAGCCCTGGCTGGCCTGGAACTCACACAGATTTACCTTACAGTTGCCAGGAGGATAAAGGGTGTGGT
GTCGCACAATTCCTAGCAAGGGCTTTTAACTTAACATGCAGTCACTCACCTGACAAGCTCCAAAGATTTTTCTTTCTTTT
TCCTGCCACTTCTTCCTGAACGTCACACAGCATACATTCAATCCTCATAACTGGCGTCAATGAAGGTCAGCCTGGGGGAC
CTTTTAATCTCCAAAGTGGGCCGTTTCTTGGGACTGACAGTCTCTTGAAATGGGAGACTCTTTGTGCTGGTCTGGAGCTC
AGACAGCACGTCGTGCTCTTTTTTCCCAAGATAGAGAATATGATTATTCTCAATGATGTGGTGGTCCAGGGAGACCAGCA
CCTTTCAATCCATTTCCTGGGCCTCACACATCTCTCCACTTTTACACCCATGAGATTGATGGCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10130E9BBF1
Sequence
AAACCAATAATATTCCAGAGTGCTCTCTGTGAATAGAGAAGATGGAACGGAAACAGAAAGGAGCGAAATGGTGAACCCCA
ATCTCCCAAAGCCAGGTGCAATCCCAACACAGGGCAGATAGAGGCAGGAGGATCAGGAGTTTAAGTCTACCCTAGCCTCA
AAGTAAGTTGGAGACTAACCTGCCCTACATACTATCCCATCTTCAAACAAAGCAGTCAGTTCTCCCAAGTGTTCCTTCTG
GTCGCATATATTTGGGTCTTTGTGGATAACAGACTGAGTGAAGAAAATAAACCGTTCTGGCTCAGACTTAGGCTATTTGC
TTTTCATGATTGGGGGGTGTAAATGTTTTTGTTTATTCCCTGAGACTTTCATACATGTAGACAATGCATTCATATTCACC
CCCCATTCTTCTGTCCCAGTTCCTCTTAGACCTCCCTGTTGGGATGACCCACTAATATTGTATTTACTGTGTGCGTTCTC
AATTGTTAATTGTTGGGCCAGGCTGAACCAGGCCTAGCGGGATATGTAATGCCTTGTCACATT
Sequence Type genomic DNA
Unitrap ID UNI13373

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35964738..35965276 522
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022906 (Parp9) NM_030253 poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI (curated);Acc:Parp9-001]

 
Come back to gene ENSMUSG00000022906


For any suggestions or comments, please send an email to unitrap@crg.es