Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12508E11
Clone ID IST12508E11
Vector VICTR76
Project tigm

Sequence tag IST12508E11BBF1
Sequence
TTAGTAGATTTAAAATTGAGTTCAAATCCATTATACTTCCTTTTCTCTTCCTTTGGTTAAAATATATTCTGGCATTCTCT
GGGCATCCAGCCAGTTCTGAAATAACTGCCTTTACTGAAACGGTTTTTGTGATGTCTACATAAGCTGTGAGATTGGAATC
TTCATTTGTTGGACATAATAATCTTAGTACTTTTAAGTGCTTTGACCTATAGAGTTTAAAGACACAGGAGACGGGCCTGC
CGGCCTGCCTGCCTCTCTCCCTCCCTCCCTCTTCCTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI6313

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 119089234..119089527 294
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018076 (Med13l) NP_766012 mediator complex subunit 13-like Gene [Source:MGI Symbol;Acc:MGI:2670178]

 
Come back to gene ENSMUSG00000018076


For any suggestions or comments, please send an email to unitrap@crg.es