Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14405A9
Clone ID IST14405A9
Vector VICTR74
Project tigm

Sequence tag IST14405A9HMR1
Sequence
CTCTCATTTACCAATGCTAAACAAGTAGAAGTATAATATGAAAATTTTTCATTGTAGAAATACGCTAACTTGATAGCTAT
CATGTTC
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66650927..66651012 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]


Sequence tag IST14405A9BBF1
Sequence
AGAGAACACTGGCTCCTTCTCAAAAGGACTTTCAATCTTTGGACATTTTCTGTTTCTTGTCCAAACACTTCAGGCCAAAG
CATCAAGGATAACCCCCCCCCCCCAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66650817..66650930 112
NO GENE  

 
Come back to gene ENSMUSG00000037876


For any suggestions or comments, please send an email to unitrap@crg.es