Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14853F12
Clone ID IST14853F12
Vector VICTR76
Project tigm

Sequence tag IST14853F12HMF1
Sequence
GGCCCATATCCTCCACCACTTCTCCCCTGTCTGGGTTTACAGCAGGGGGTTCAGCTGGTGCTGGGCGCGGGCAAGAAGGC
CAAGACACCCTTGTTTCTGGTGGTATTCCCACCATGGAAGGGGATCAAAAGCAGGGACCTAAACCTCTGGGTCCTGGTGC
CATTGGGCACCCTCCTGTGGACTGNNANNCTNNGNNANNCAN
Sequence Type genomic DNA
Unitrap ID UNI23051

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4969858..4970041 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051184 (Zfp524) NM_025324 zinc finger protein 524 Gene [Source:MGI Symbol;Acc:MGI:1916740]

 
Come back to gene ENSMUSG00000051184


For any suggestions or comments, please send an email to unitrap@crg.es